pSHUT4-eYFP
(Plasmid #133094)

• Purpose: Agrobacterium T-DNA overexpression cassette comprising constitutive TEF-1alpha fused to reporter eYFP. Integrates near beta-tubulin gene in F. solani genome. Replace eYFP w/ XhoI BamHI
• Depositing Lab: Jens Laurids Sørensen
• Publication: Nielsen et al Fungal Biol Biotechnol. 2019 Dec 11;6:25. doi: 10.1186/s40694-019-0089-2. eCollection 2019.

Backbone

• Vector backbone: pSHUT3
• Backbone manufacturer: In-house plasmid
• Total vector size (bp): 10460
• Modifications to backbone: Backbone is U-GOTL modified with URA3 from pYES2(Invitrogen) and CEN-ARS from pRS315 (ATCC 77144)
• Vector type: Fungal expression
• Selectable markers: Gentamicin, URA3

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: enhanced yellow flourescent protein
• Alt name: eYFP
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: TEF-1α

Cloning Information

• Cloning method: Ligation Independent Cloning
• 5′ sequencing primer: TTTCCCCCATACCTCCTTTC
• 3′ sequencing primer: AAGACCGGCAACAGGATTC

Resource Information

• Supplemental Documents:
  • pSHUT4-eYFP.gbk
• A portion of this plasmid was derived from a plasmid made by: Agrobacterium T-DNA cassette taken from p-UGOTL-TEF1α-eYFP (Lukassen et al, Mar Drugs 2015, 13:4331-4343.) holding the eYFP gene from EarleyGate 104 (Earley et al. The Plant Journal 2006, 45(4):616-629.)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry