pET14b-dabAB2
(Plasmid #133013)

• Purpose: pET14b carrying the dabA2 gene (Uniprot: D0KWS7) with a c-terminal strep tag fusion and the dabB2 gene (Uniprot: D0KWS8) with a c-terminal sfGFP V206K fusion and 6xHis tag
• Depositing Lab: David Savage
• Publication: Desmarais et al Nat Microbiol. 2019 Aug 12. pii: 10.1038/s41564-019-0520-8. doi: 10.1038/s41564-019-0520-8.

Backbone

• Vector backbone: pET14b
• Backbone size w/o insert (bp): 4607
• Total vector size (bp): 9560
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: dabB2
• Species: Halothiobacillus neapolitanus c2
• Insert Size (bp): 1653
• GenBank ID: WP_012823111.1
• Promoter: t7
• Tags / Fusion Proteins:
  • sfGFP (C terminal on insert)
  • 6xHis (C terminal on insert)

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: TAATACGACTCACTATAGGG

Gene/Insert 2

• Gene/Insert name: dabA2
• Species: Halothiobacillus neapolitanus c2
• Insert Size (bp): 2481
• GenBank ID: WP_012823110.1
• Promoter: t7
• Tag / Fusion Protein:
  • StrepII tag (C terminal on insert)

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: Caaaggcacacaccatttacc

Resource Information

• Supplemental Documents:
  • pjjd060_dab2_gfp_his_strep.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry