pFE-dabAB2 H524A
(Plasmid #133007)

• Purpose: pFE carrying a dabA2 gene (Uniprot: D0KWS7) with a H524A mutation and a dabB2 gene (Uniprot: D0KWS8)
• Depositing Lab: David Savage
• Publication: Desmarais et al Nat Microbiol. 2019 Aug 12. pii: 10.1038/s41564-019-0520-8. doi: 10.1038/s41564-019-0520-8.

Backbone

• Vector backbone: pFE
• Backbone size w/o insert (bp): 3132
• Total vector size (bp): 7317
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: dabB2
• Species: Halothiobacillus neapolitanus c2
• Insert Size (bp): 1653
• GenBank ID: WP_012823111.1
• Promoter: tetR

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CCTTTCGTCTTCACCTCGAG

Gene/Insert 2

• Gene/Insert name: dabA2
• Species: Halothiobacillus neapolitanus c2
• Insert Size (bp): 2481
• Mutation: H524A
• GenBank ID: WP_012823110.1
• Promoter: tetR

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: TCGCCTTGTTTGTTCAC

Resource Information

• Supplemental Documents:
  • pjjd019_pfe_double_dhis1.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry