pFE-vcDAB
(Plasmid #133004)

• Purpose: pFE carrying the vcdabA2 ( locus_tag: CSW01_RS07960) and vcdabB2 genes (locus_tag: CSW01_RS07955)
• Depositing Lab: David Savage
• Publication: Desmarais et al Nat Microbiol. 2019 Aug 12. pii: 10.1038/s41564-019-0520-8. doi: 10.1038/s41564-019-0520-8.

Backbone

• Vector backbone: pFE
• Backbone size w/o insert (bp): 3132
• Total vector size (bp): 7196
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert 1

• Gene/Insert name: vcdabB
• Species: Vibrio cholerae strain E7946 El Tor Ogawa
• Insert Size (bp): 1551
• GenBank ID: CSW01_RS07955
• Promoter: tetR

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: GCGTTCACCGACAAACAACAGA

Gene/Insert 2

• Gene/Insert name: vcdabA
• Species: Vibrio cholerae strain E7946 El Tor Ogawa
• Insert Size (bp): 2589
• GenBank ID: CSW01_RS07960
• Promoter: tetR

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: gcgttcaccgacaaacaacaga

Resource Information

• Supplemental Documents:
  • pfe_cholera.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry