Skip to main content
Addgene

pDR-nfatc1_sgRNA2
(Plasmid #132978)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132978 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pDR274
  • Backbone size w/o insert (bp) 2126
  • Total vector size (bp) 2145
  • Vector type
    CRISPR ; sgRNA generation vector

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    nfatc1 sgRNA2 target sequence
  • gRNA/shRNA sequence
    GTGGGAGCTCCATTGGATCG
  • Species
    D. rerio (zebrafish)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BsaI (destroyed during cloning)
  • 3′ cloning site BsaI (destroyed during cloning)
  • 5′ sequencing primer M13R-pUC
  • 3′ sequencing primer M13F
    • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDR-nfatc1_sgRNA2 was a gift from Nathan Lawson (Addgene plasmid # 132978 ; http://n2t.net/addgene:132978 ; RRID:Addgene_132978)

  • For your References section:

    Valves Are a Conserved Feature of the Zebrafish Lymphatic System. Shin M, Nozaki T, Idrizi F, Isogai S, Ogasawara K, Ishida K, Yuge S, Roscoe B, Wolfe SA, Fukuhara S, Mochizuki N, Deguchi T, Lawson ND. Dev Cell. 2019 Nov 4;51(3):374-386.e5. doi: 10.1016/j.devcel.2019.08.019. Epub 2019 Sep 26. 10.1016/j.devcel.2019.08.019 PubMed 31564611
Related items: