Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

1647_pGL4.51 TLV41 SSA-Luc cloning vector_Circular
(Plasmid #132962)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132962 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pGL4.51
  • Backbone manufacturer
    Promega
  • Total vector size (bp) 6727
  • Modifications to backbone
    Stop sequences between Firefly Luciferase sequence
  • Vector type
    Mammalian Expression, CRISPR, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Firefly Luciferase
  • Species
    Synthetic
  • Mutation
    Stop sequence between luciferase gene
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (destroyed during cloning)
  • 3′ cloning site SbfI (destroyed during cloning)
  • 5′ sequencing primer TTACCGACGCACATATCGAG
  • 3′ sequencing primer TGACTGAATCGGACACAAGC
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    1647_pGL4.51 TLV41 SSA-Luc cloning vector_Circular was a gift from Gang Bao (Addgene plasmid # 132962 ; http://n2t.net/addgene:132962 ; RRID:Addgene_132962)
  • For your References section:

    High-throughput cellular screening of engineered nuclease activity using the single-strand annealing assay and luciferase reporter. Cradick TJ, Antico CJ, Bao G. Methods Mol Biol. 2014;1114:339-52. doi: 10.1007/978-1-62703-761-7_22. 10.1007/978-1-62703-761-7_22 PubMed 24557914