Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

BE3-hA3A-R128A
(Plasmid #132944)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132944 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    X330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone manufacturer
    Feng Zhang Lab (Addgene#: 42230)
  • Vector type
    Mammalian Expression, CRISPR ; Base editor

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BE3-hA3A(R128A)
  • gRNA/shRNA sequence
    GGCCCAGACTGAGCACGTGA
  • Species
    Synthetic
  • Insert Size (bp)
    7937
  • Mutation
    BE3-hA3A(R128A)

Cloning Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BE3-hA3A-R128A was a gift from Hui Yang (Addgene plasmid # 132944 ; http://n2t.net/addgene:132944 ; RRID:Addgene_132944)
  • For your References section:

    Off-target RNA mutation induced by DNA base editing and its elimination by mutagenesis. Zhou C, Sun Y, Yan R, Liu Y, Zuo E, Gu C, Han L, Wei Y, Hu X, Zeng R, Li Y, Zhou H, Guo F, Yang H. Nature. 2019 Jul;571(7764):275-278. doi: 10.1038/s41586-019-1314-0. Epub 2019 Jun 10. 10.1038/s41586-019-1314-0 PubMed 31181567