pPU-huTRIMmiR30-L1221
(Plasmid
#132937)
-
PurposeAll-in-one huTRIM5 rescue-control shRNA knockdown
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132937 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPU-Empty-miR30
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman TRIM5
-
gRNA/shRNA sequenceTACAAACGCTCTCATCGACAAG
-
SpeciesH. sapiens (human)
- Promoter SFFV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (unknown if destroyed)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPU-huTRIMmiR30-L1221 was a gift from Jeremy Luban (Addgene plasmid # 132937 ; http://n2t.net/addgene:132937 ; RRID:Addgene_132937) -
For your References section:
Cyclophilin A protects HIV-1 from restriction by human TRIM5alpha. Kim K, Dauphin A, Komurlu S, McCauley SM, Yurkovetskiy L, Carbone C, Diehl WE, Strambio-De-Castillia C, Campbell EM, Luban J. Nat Microbiol. 2019 Dec;4(12):2044-2051. doi: 10.1038/s41564-019-0592-5. Epub 2019 Oct 21. 10.1038/s41564-019-0592-5 PubMed 31636416