Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDRF1-GW yAT1.03
(Plasmid #132781)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132781 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pDRF1-GW
  • Vector type
    Yeast Expression
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    yAT1.03 ymTq2-tdTomato
  • Species
    B. Subtilis

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI, SpeI, XbaI (unknown if destroyed)
  • 3′ cloning site NotI (unknown if destroyed)
  • 5′ sequencing primer AACAATCGTTAATAATTAATTAATTGG
  • 3′ sequencing primer GAGTCACTTTAAAATTTGTATACAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDRF1-GW yAT1.03 was a gift from Bas Teusink (Addgene plasmid # 132781 ; http://n2t.net/addgene:132781 ; RRID:Addgene_132781)
  • For your References section:

    An Improved ATP FRET Sensor For Yeast Shows Heterogeneity During Nutrient Transitions. Botman D, van Heerden JH, Teusink B. ACS Sens. 2020 Mar 27;5(3):814-822. doi: 10.1021/acssensors.9b02475. Epub 2020 Mar 3. 10.1021/acssensors.9b02475 PubMed 32077276