pUCIDT-Lion1
(Plasmid
#132755)
-
PurposeEncodes an iconic representation of a lion
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132755 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepUCIDT-Amp
-
Backbone manufacturerIDT
- Backbone size w/o insert (bp) 2761
- Total vector size (bp) 3066
-
Vector typeUnspecified
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameLion1
-
SpeciesSynthetic
-
Insert Size (bp)313
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer gaattcgtcgtcgtcccctcaaact
- 3′ sequencing primer ctgcagattgatgccaccttttcagc (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCIDT-Lion1 was a gift from Mark Bathe (Addgene plasmid # 132755 ; http://n2t.net/addgene:132755 ; RRID:Addgene_132755) -
For your References section:
Random access DNA memory using Boolean search in an archival file storage system. Banal JL, Shepherd TR, Berleant J, Huang H, Reyes M, Ackerman CM, Blainey PC, Bathe M. Nat Mater. 2021 Sep;20(9):1272-1280. doi: 10.1038/s41563-021-01021-3. Epub 2021 Jun 10. 10.1038/s41563-021-01021-3 PubMed 34112975