Skip to main content
Addgene

pJYScr
(Plasmid #132719)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132719 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pJYS2_crtYf
  • Backbone manufacturer
    Yang S
  • Backbone size (bp) 4380
  • Modifications to backbone
    Modification of restriction sites, insertion of an 931 bp BamHI-BstBI-dummy fragment
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • 5′ sequencing primer pJYS2_fw2 GTGTCAGTGAAAGGCGCATCC
  • 3′ sequencing primer pJYS2_rv2 TCGCCACCTCTGACTTGAGCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJYScr was a gift from Jan Marienhagen (Addgene plasmid # 132719 ; http://n2t.net/addgene:132719 ; RRID:Addgene_132719)
  • For your References section:

    CRISPR/Cas12a Mediated Genome Editing To Introduce Amino Acid Substitutions into the Mechanosensitive Channel MscCG of Corynebacterium glutamicum. Krumbach K, Sonntag CK, Eggeling L, Marienhagen J. ACS Synth Biol. 2019 Dec 11. doi: 10.1021/acssynbio.9b00361. 10.1021/acssynbio.9b00361 PubMed 31790583