AAV8-hSyn-flex-miR30-eGFP-shDyn
(Plasmid
#132716)
-
PurposeEncodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Pdyn gene, which encodes dynorphin
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132716 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-hSyn-flex-miR30
-
Backbone manufacturerAddgene Plasmid #6745
- Backbone size w/o insert (bp) 4811
- Total vector size (bp) 5950
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameGFP-shDyn
-
Alt nameGFP-shCrh fragment from pPRIME-CMV-GFP- shDyn(1) vector
-
SpeciesR. norvegicus (rat)
-
Insert Size (bp)1138
-
GenBank IDNM_019374
-
Entrez GenePdyn
- Promoter Synapsin 1
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer TGCCTGAGAGCGCAGTCG
- 3′ sequencing primer AGCAGCGTATCCACATAGCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV8-hSyn-flex-miR30-eGFP-shDyn was a gift from Robert Messing (Addgene plasmid # 132716 ; http://n2t.net/addgene:132716 ; RRID:Addgene_132716) -
For your References section:
Dissecting the Roles of GABA and Neuropeptides from Rat Central Amygdala CRF Neurons in Anxiety and Fear Learning. Pomrenze MB, Giovanetti SM, Maiya R, Gordon AG, Kreeger LJ, Messing RO. Cell Rep. 2019 Oct 1;29(1):13-21.e4. doi: 10.1016/j.celrep.2019.08.083. 10.1016/j.celrep.2019.08.083 PubMed 31577943