AAV8-hSyn-flex-miR30-eGFP-shDyn
(Plasmid #132716)

• Purpose: Encodes Cre-dependent short hairpin RNA (shRNA) that targets the 3’-untranslated region of the rat Pdyn gene, which encodes dynorphin
• Depositing Lab: Robert Messing
• Publication: Pomrenze et al Cell Rep. 2019 Oct 1;29(1):13-21.e4. doi: 10.1016/j.celrep.2019.08.083.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV-hSyn-flex-miR30
• Backbone manufacturer: Addgene Plasmid #6745
• Backbone size w/o insert (bp): 4811
• Total vector size (bp): 5950
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Low Copy

Gene/Insert

• Gene/Insert name: GFP-shDyn
• Alt name: GFP-shCrh fragment from pPRIME-CMV-GFP- shDyn(1) vector
• Species: R. norvegicus (rat)
• Insert Size (bp): 1138
• GenBank ID: NM_019374
• Entrez Gene: Pdyn
• Promoter: Synapsin 1

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: NheI (not destroyed)
• 5′ sequencing primer: TGCCTGAGAGCGCAGTCG
• 3′ sequencing primer: AGCAGCGTATCCACATAGCG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry