pPRIME-CMV-GFP-shCrh2
(Plasmid
#132710)
-
PurposeEncodes short hairpin RNA (shRNA) #2 that targets the 3’-untranslated region of the rat Crh gene
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132710 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepPRIME-CMV-GFP-recipient
-
Backbone manufacturerAddgene Plasmid #11657
- Backbone size w/o insert (bp) 8491
- Total vector size (bp) 8608
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshCrh(2)
-
Alt namesmall hairpin RNA targeting the 3’-untranslated regions (UTR) of rat proCrh
-
SpeciesR. norvegicus (rat)
-
GenBank IDNM_031019
-
Entrez GeneCrh (a.k.a. CRF)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XhoI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TCTTGTAGTTGCCGTCGTC
- 3′ sequencing primer GCTGAACGGTCTGGTTATAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPRIME-CMV-GFP-shCrh2 was a gift from Robert Messing (Addgene plasmid # 132710 ; http://n2t.net/addgene:132710 ; RRID:Addgene_132710) -
For your References section:
Dissecting the Roles of GABA and Neuropeptides from Rat Central Amygdala CRF Neurons in Anxiety and Fear Learning. Pomrenze MB, Giovanetti SM, Maiya R, Gordon AG, Kreeger LJ, Messing RO. Cell Rep. 2019 Oct 1;29(1):13-21.e4. doi: 10.1016/j.celrep.2019.08.083. 10.1016/j.celrep.2019.08.083 PubMed 31577943