pENN.AAV.CB7.CI.ACY1-flag.WPRE.rBG
(Plasmid #132686)

• Purpose: AAV plasmid encoding mouse ACY1 with C-terminal flag tag
• Depositing Lab: Jonathan Long
• Publication: Kim et al Cell Chem Biol. 2019 Nov 21;26(11):1623-1629.e3. doi: 10.1016/j.chembiol.2019.09.009. Epub 2019 Oct 3.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pENN.AAV.CB7.CI.insert.WPRE.rBG
• Backbone manufacturer: Penn Vector Core
• Backbone size w/o insert (bp): 5700
• Total vector size (bp): 7000
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Acylase I
• Alt name: ACY1
• Species: M. musculus (mouse)
• Insert Size (bp): 1300
• Entrez Gene: Acy1 (a.k.a. 1110014J22Rik, Acy-1)
• Entrez Gene: Acy1 (a.k.a. Acy-1)
• Promoter: Chicken b-actin
• Tag / Fusion Protein:
  • Flag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: n/a
• 3′ sequencing primer: WPRE-R, CATAGCGTAAAAGGAGCAACA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry