pENN.AAV.CB7.CI.CNDP2-flag.WPRE.rBG
(Plasmid #132685)

• Purpose: AAV plasmid encoding mouse CNDP2 with C-terminal flag tag
• Depositing Lab: Jonathan Long
• Publication: Kim et al Cell Chem Biol. 2019 Nov 21;26(11):1623-1629.e3. doi: 10.1016/j.chembiol.2019.09.009. Epub 2019 Oct 3.

Backbone

• Vector backbone: pENN.AAV.CB7.CI.insert.WPRE.rBG
• Backbone manufacturer: Penn Vector Core
• Backbone size w/o insert (bp): 5700
• Total vector size (bp): 7200
• Vector type: AAV

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: Carnosine dipeptidase 2
• Alt name: CNDP2
• Species: M. musculus (mouse)
• Insert Size (bp): 1500
• Entrez Gene: Cndp2 (a.k.a. 0610010E05Rik, Cn2, Dip-2, Pep-1, Pep1)
• Promoter: Chicken b-actin
• Tag / Fusion Protein:
  • Flag (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoRV (not destroyed)
• 3′ cloning site: XhoI (not destroyed)
• 5′ sequencing primer: n/a
• 3′ sequencing primer: WPRE-R, CATAGCGTAAAAGGAGCAACA

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry