pENN.AAV.CB7.CI.CNDP1-flag.WPRE.rBG
(Plasmid
#132683)
-
PurposeAAV plasmid encoding mouse CNDP1 with C-terminal flag tag
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132683 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepENN.AAV.CB7.CI.insert.WPRE.rBG
-
Backbone manufacturerPenn Vector Core
- Backbone size w/o insert (bp) 5700
- Total vector size (bp) 7300
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCarnosine dipeptidase 1
-
Alt nameCNDP1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1500
-
Entrez GeneCndp1 (a.k.a. AI746433, Cn1)
- Promoter Chicken b-actin
-
Tag
/ Fusion Protein
- Flag (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site XhoI (not destroyed)
- 5′ sequencing primer n/a
- 3′ sequencing primer WPRE-R, CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pENN.AAV.CB7.CI.CNDP1-flag.WPRE.rBG was a gift from Jonathan Long (Addgene plasmid # 132683 ; http://n2t.net/addgene:132683 ; RRID:Addgene_132683) -
For your References section:
Family-wide Annotation of Enzymatic Pathways by Parallel In Vivo Metabolomics. Kim JT, Li VL, Terrell SM, Fischer CR, Long JZ. Cell Chem Biol. 2019 Nov 21;26(11):1623-1629.e3. doi: 10.1016/j.chembiol.2019.09.009. Epub 2019 Oct 3. 10.1016/j.chembiol.2019.09.009 PubMed 31587987