Skip to main content
Addgene

pENN.AAV.CB7.CI.PM20D1-flag.WPRE.rBG
(Plasmid #132682)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132682 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pENN.AAV.CB7.CI.insert.WPRE.rBG
  • Backbone manufacturer
    Penn Vector Core
  • Backbone size w/o insert (bp) 5700
  • Total vector size (bp) 7300
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Peptidase M20 domain containing 1
  • Alt name
    PM20D1
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1600
  • Entrez Gene
    Pm20d1 (a.k.a. 4732466D17Rik, AI098026)
  • Promoter Chicken b-actin
  • Tags / Fusion Proteins
    • Flag (C terminal on insert)
    • 6xHIS (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer n/a
  • 3′ sequencing primer WPRE-R, CATAGCGTAAAAGGAGCAACA
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pENN.AAV.CB7.CI.PM20D1-flag.WPRE.rBG was a gift from Jonathan Long (Addgene plasmid # 132682 ; http://n2t.net/addgene:132682 ; RRID:Addgene_132682)

  • For your References section:

    Family-wide Annotation of Enzymatic Pathways by Parallel In Vivo Metabolomics. Kim JT, Li VL, Terrell SM, Fischer CR, Long JZ. Cell Chem Biol. 2019 Nov 21;26(11):1623-1629.e3. doi: 10.1016/j.chembiol.2019.09.009. Epub 2019 Oct 3. 10.1016/j.chembiol.2019.09.009 PubMed 31587987
Related items:
Commonly requested with: