Hy_pHml eGFP SV40
(Plasmid
#132645)
-
PurposeExpresses eGFP mRNA from the Drosophila Hml promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132645 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backboneHy_pMtnA eGFP
- Total vector size (bp) 8196
-
Vector typeInsect Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameeGFP
- Promoter Hml
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRV (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer CTACCTGCCTGGACAGCATG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Hy_pHml eGFP SV40 was a gift from Jeremy Wilusz (Addgene plasmid # 132645 ; http://n2t.net/addgene:132645 ; RRID:Addgene_132645) -
For your References section:
The Integrator complex cleaves nascent mRNAs to attenuate transcription. Tatomer DC, Elrod ND, Liang D, Xiao MS, Jiang JZ, Jonathan M, Huang KL, Wagner EJ, Cherry S, Wilusz JE. Genes Dev. 2019 Sep 17. pii: gad.330167.119. doi: 10.1101/gad.330167.119. 10.1101/gad.330167.119 PubMed 31530651