Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pErCas12a EZ Clone
(Plasmid #132641)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132641 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pX601-AAV-CMV::NLS-SaCas9-NLS-3xHAbGHpA;U6::BsaI-sgRNA
  • Backbone manufacturer
    Dr. Feng Zhang
  • Backbone size w/o insert (bp) 4206
  • Total vector size (bp) 8046
  • Vector type
    Mammalian Expression, AAV, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ErCas12a
  • Alt name
    Mad7
  • Species
    Eubacterium rectale
  • Insert Size (bp)
    3840
  • Mutation
    Q926R (Please see depositor comments) and BsaI site removed via SDM on ErCas12a gene sequence with a silent mutation
  • GenBank ID
    MH347339.1
  • Promoter CMV Promoter
  • Tags / Fusion Proteins
    • SV40 NLS (N terminal on insert)
    • SV40 NLS (C terminal on insert)
    • 3x HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BamHi (not destroyed)
  • 5′ sequencing primer GCTCTCTGGCTAACTACCGGT
  • 3′ sequencing primer GGTACCTCCCCAGCATGCCT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The codon optimized sequence of this gene was ordered as a geneblock from IDT from Jeff Essner's lab, who is co-corresponding author of the manuscript this construct is derived from.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Q926R mutation in ErCas12a does not affect function. This plasmid was used successfully in associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pErCas12a EZ Clone was a gift from Stephen Ekker (Addgene plasmid # 132641 ; http://n2t.net/addgene:132641 ; RRID:Addgene_132641)
  • For your References section:

    Expanding the CRISPR Toolbox with ErCas12a in Zebrafish and Human Cells. Wierson WA, Simone BW, WareJoncas Z, Mann C, Welker JM, Kar B, Emch MJ, Friedberg I, Gendron WAC, Barry MA, Clark KJ, Dobbs DL, McGrail MA, Ekker SC, Essner JJ. CRISPR J. 2019 Dec;2(6):417-433. doi: 10.1089/crispr.2019.0026. Epub 2019 Nov 19. 10.1089/crispr.2019.0026 PubMed 31742435