pErCas12a EZ Clone
(Plasmid #132641)

• Purpose: Expresses ErCas12a and an sgRNA to target a region of interest
• Depositing Lab: Stephen Ekker
• Publication: Wierson et al CRISPR J. 2019 Dec;2(6):417-433. doi: 10.1089/crispr.2019.0026. Epub 2019 Nov 19.

Backbone

• Vector backbone: pX601-AAV-CMV::NLS-SaCas9-NLS-3xHAbGHpA;U6::BsaI-sgRNA
• Backbone manufacturer: Dr. Feng Zhang
• Backbone size w/o insert (bp): 4206
• Total vector size (bp): 8046
• Vector type: Mammalian Expression, AAV, CRISPR

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: ErCas12a
• Alt name: Mad7
• Species: Eubacterium rectale
• Insert Size (bp): 3840
• Mutation: Q926R (Please see depositor comments) and BsaI site removed via SDM on ErCas12a gene sequence with a silent mutation
• GenBank ID: MH347339.1
• Promoter: CMV Promoter
• Tags / Fusion Proteins:
  • SV40 NLS (N terminal on insert)
  • SV40 NLS (C terminal on insert)
  • 3x HA (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: BamHi (not destroyed)
• 5′ sequencing primer: GCTCTCTGGCTAACTACCGGT
• 3′ sequencing primer: GGTACCTCCCCAGCATGCCT

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The codon optimized sequence of this gene was ordered as a geneblock from IDT from Jeff Essner's lab, who is co-corresponding author of the manuscript this construct is derived from.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Q926R mutation in ErCas12a does not affect function. This plasmid was used successfully in associated publication.