pCW57.1-GFP_mmu-miR-16-5p_sponge
(Plasmid #132624)

• Purpose: Expresses a TurboGFP transcript with microRNA sponge for mmu-miR-16-5p as 3'UTR
• Depositing Lab: Constance Ciaudo
• Publication: Ciaudo Lab plasmids (unpublished)

Backbone

• Vector backbone: pCW57-GFP-2A-MCS
• Backbone manufacturer: Adam Karpf Lab (addgene#: 71783)
• Backbone size w/o insert (bp): 8405
• Modifications to backbone: Cloning performed in 2 steps: 1) Generation of pCW57.1-GFP_mmu-miR-292b-3p_sponge plasmid by AgeI and BamHI restriction on pCW57.1-GFP and cloning of preparation insert containing a stop codon, a sponge design and polyA signal, separated by a PacI restriction enzyme site 2) AgeI and PacI restriction on the newly generated plasmid and insertion of orderded oligos.
• Vector type: Mammalian Expression, Lentiviral ; Doxycycline inducible
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: stop codon, mmu-miR-16-5p sponge sequence and polyA signal
• Species: M. musculus (mouse); Mammals
• Insert Size (bp): 459
• Promoter: TRE

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: unknown
• 3′ sequencing primer: GAACGGACGTGAAGAATGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry