pCW57.1-RFP_mmu-miR-292b-3p_sponge
(Plasmid #132623)

• Purpose: Expresses a TurboRFP transcript with test microRNA sponge for mmu-miR-292b-3p as 3'UTR; serves as template for other microRNA sponges
• Depositing Lab: Constance Ciaudo
• Publication: Ciaudo Lab plasmids (unpublished)

Backbone

• Vector backbone: pCW57-RFP-P2A-MCS (Neo)
• Backbone manufacturer: Adam Karpf Lab (addgene#: 89182)
• Backbone size w/o insert (bp): 8636
• Modifications to backbone: cloning method: AgeI and BamHI restriction on pCW57.1-RFP, insert design with compatible restriction enzyme sites. The insert contains a stop codon, the sponge design and a polyA signal. An additional restriction enzyme site, PacI, is introduced between the sponge design and polyA signal to facilitate efficient generation of alternative sponge designs.
• Vector type: Mammalian Expression, Lentiviral ; Doxycycline inducible
• Selectable markers: Neomycin (select with G418)

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: stop codon, mmu-miR-292b-3p sponge sequence and polyA signal
• Species: M. musculus (mouse)
• Insert Size (bp): 184
• Promoter: TRE

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: unknown
• 3′ sequencing primer: GAACGGACGTGAAGAATGTG

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry