pN_35S/mEGFP
(Plasmid #132565)

• Purpose: mEGFP expression regulated by the CaMV35S promoter, co-expressed nourseothricin acetyl transferase selectable marker (nat)
• Depositing Lab: Mathias Pribil
• Publication: Behrendorff et al Physiol Plant. 2020 Feb 25. doi: 10.1111/ppl.13079.

Backbone

• Vector backbone: pN_35S
• Backbone size w/o insert (bp): 9267
• Total vector size (bp): 9987
• Vector type: Plant Expression
• Selectable markers: Nourseothricin/streptothricin

Growth in Bacteria

• Bacterial Resistance(s): Spectinomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: mEGFP
• Alt name: monomeric enhanceed green fluorescent protein
• Species: Synthetic
• Insert Size (bp): 720
• Promoter: Cauliflower mosaic virus 35S

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: CTCGGATTCCATTGCCCAGCTAT
• 3′ sequencing primer: ATATGCTCAACACATGAGCGA

Resource Information

• Supplemental Documents:
  • pN_35S_mEGFP.gb
• A portion of this plasmid was derived from a plasmid made by: mEGFP was amplified from mEGFP-pBAD, a gift from Michael Davidson (Addgene plasmid # 54622 ; http://n2t.net/addgene:54622 ; RRID:Addgene_54622).

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Please visit https://www.biorxiv.org/content/10.1101/852020v1 for bioRxiv preprint.