pspCas9-ABE-3'UTR-sgRNA-Tetra-com-vector
(Plasmid #132560)

• Purpose: Vector plasmid expressing ABEmax and sgRNA scaffold with com replacing the Tetraloop.
• Depositing Lab: Baisong Lu
• Publication: Lyu et al CRISPR J. 2021 Feb;4(1):69-81. doi: 10.1089/crispr.2020.0095.

Backbone

• Vector backbone: pcDNA3.1
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert 1

• Gene/Insert name: ABEmax
• Promoter: CMV

Cloning Information for Gene/Insert 1

• Cloning method: Unknown
• 5′ sequencing primer: CMV-R: tgccaagtgggcagtttac

Gene/Insert 2

• Gene/Insert name: sgRNA, with Tetraloop replaced by com aptamer

Cloning Information for Gene/Insert 2

• Cloning method: Unknown
• 5′ sequencing primer: LKO-F:   GACTATCATATGCTTACCGT

Resource Information

• Supplemental Documents:
  • snapgene sequence file

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry