AAV-U6-gRNA-TnT-Cre
(Plasmid
#132551)
-
PurposeFor loss-of-function experiments in cardiomyocytes
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132551 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 2896
- Total vector size (bp) 5597
-
Vector typeAAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert 1
-
Gene/Insert nameTnT-Cre
-
Insert Size (bp)1797
- Promoter TnT
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GTGGCACCGAGTCGGTGCTT
- 3′ sequencing primer GCACTGGGGAGGGGTCACAG (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameU6-gRNA
-
Insert Size (bp)349
- Promoter U6
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer ACGCGTGAGGGCCTATTTCC
- 3′ sequencing primer CGCTTCGGACCCGACCCTCT (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-U6-gRNA-TnT-Cre was a gift from William Pu (Addgene plasmid # 132551 ; http://n2t.net/addgene:132551 ; RRID:Addgene_132551)