Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pCW57-GFP-miR-302cluster
(Plasmid #132549)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132549 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pCW57-GFP-2A-MCS
  • Backbone manufacturer
    Broad Insitute
  • Backbone size w/o insert (bp) 8405
  • Total vector size (bp) 9043
  • Vector type
    Mammalian Expression, Lentiviral ; Doxycycline inducible, microRNA expression
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    human miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    722
  • GenBank ID
    442894, 442895, 407028, 442896, 442912
  • Tag / Fusion Protein
    • GFP

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer GAGGATCACAGCAACACCGA
  • 3′ sequencing primer CCTTGGAAAAGGCGCAACC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783).

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pCW57-GFP-miR-302cluster was a gift from Tomáš Bárta (Addgene plasmid # 132549 ; http://n2t.net/addgene:132549 ; RRID:Addgene_132549)
  • For your References section:

    Oct4-mediated reprogramming induces embryonic-like microRNA expression signatures in human fibroblasts. Peskova L, Cerna K, Oppelt J, Mraz M, Barta T. Sci Rep. 2019 Oct 31;9(1):15759. doi: 10.1038/s41598-019-52294-3. 10.1038/s41598-019-52294-3 PubMed 31673026