pCW57-GFP-miR-302cluster
(Plasmid #132549)

• Purpose: Doxycycline-inducible expression of human miR-302 cluster
• Depositing Lab: Tomáš Bárta
• Publication: Peskova et al Sci Rep. 2019 Oct 31;9(1):15759. doi: 10.1038/s41598-019-52294-3.

Backbone

• Vector backbone: pCW57-GFP-2A-MCS
• Backbone manufacturer: Broad Insitute
• Backbone size w/o insert (bp): 8405
• Total vector size (bp): 9043
• Vector type: Mammalian Expression, Lentiviral ; Doxycycline inducible, microRNA expression
• Selectable markers: Puromycin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: human miR-302 cluster: MIR302B, MIR302C, MIR302A, MIR302D, MIR367
• Species: H. sapiens (human)
• Insert Size (bp): 722
• GenBank ID: 442894, 442895, 407028, 442896, 442912
• Tag / Fusion Protein:
  • GFP

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AgeI (not destroyed)
• 3′ cloning site: BsrGI (not destroyed)
• 5′ sequencing primer: GAGGATCACAGCAACACCGA
• 3′ sequencing primer: CCTTGGAAAAGGCGCAACC

Resource Information

• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Evrogen Limited Use Label License for FPs
• Industry Terms:
  • Not Available to Industry

Depositor Comments

MIR302 cluster was PCR-amplified from genomic DNA using the following primers: Fwd - ACACCGGTGAAGTTGTATGTTGGGTGGGCT; Rev - CGTGTACACGTTATTTAACAATCCATCACCATTGCTAAAGT and cloned into pJET. pJET was digested using AgeI/BsrGI and inserted into AgeI/BsrGI digested pCW57-GFP-MCS vector (Addgene #71783).