-
Purposeexpresses gRNA for TBP-based CIRTS
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132547 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonecustom
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namegRNA TBP-based CIRTS
-
gRNA/shRNA sequencetgacagcccacatggcattccacttatcatggcatcctt
-
SpeciesSynthetic
- Promoter hU6 promoter
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer ggaaacagctatgaccatg (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TBP6.7 non-targeting gRNA lambda phage was a gift from Bryan Dickinson (Addgene plasmid # 132547 ; http://n2t.net/addgene:132547 ; RRID:Addgene_132547) -
For your References section:
Programmable RNA-Guided RNA Effector Proteins Built from Human Parts. Rauch S, He E, Srienc M, Zhou H, Zhang Z, Dickinson BC. Cell. 2019 Jun 27;178(1):122-134.e12. doi: 10.1016/j.cell.2019.05.049. Epub 2019 Jun 20. 10.1016/j.cell.2019.05.049 PubMed 31230714