CS2-H2B-EGFP
(Plasmid
#132414)
-
PurposeTo make synthetic mRNA encoding a nuclear EGFP
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132414 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepCS-H2B-mRFP1
-
Backbone manufacturerMegason lab (Addgene #53745)
- Backbone size w/o insert (bp) 4300
- Total vector size (bp) 5293
-
Modifications to backboneThe RFP sequence in the original vector was replaced with EGFP
-
Vector typeSynthetic mRNA production
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameH2B-EGFP
-
SpeciesSynthetic
-
Insert Size (bp)1110
-
GenBank IDNC_025025.1 NC_000001.11
-
Entrez GeneH2BC21 (a.k.a. GL105, H2B, H2B-GL105, H2B.1, H2BE, H2BFQ, H2BGL105, H2BQ, HIST2H2BE)
- Promoter SP6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer GTCGGAGCAAGCTTGATTTAGGTGAC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byEGFP was from a plasmid created by Carl-Phillipe Heisenberg
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
CS2-H2B-EGFP was a gift from David Kimelman (Addgene plasmid # 132414 ; http://n2t.net/addgene:132414 ; RRID:Addgene_132414)