Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pJH2256
(Plasmid #132365)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132365 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pBSK
  • Backbone manufacturer
    stratagene
  • Backbone size w/o insert (bp) 8291
  • Total vector size (bp) 8691
  • Vector type
    Worm Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    INS-6
  • Species
    C. elegans (nematode)
  • Insert Size (bp)
    400
  • Entrez Gene
    ins-6 (a.k.a. CELE_ZK84.6)
  • Promoter Prgef-1
  • Tag / Fusion Protein
    • GFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer gaccattaccaacgttctttc
  • 3′ sequencing primer AGGATGGGCACCACCCCGGTGAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Plasmid contains the cDNA of ins-6 based on wormbase sequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJH2256 was a gift from Mei Zhen (Addgene plasmid # 132365 ; http://n2t.net/addgene:132365 ; RRID:Addgene_132365)
  • For your References section:

    A Caenorhabditis elegans developmental decision requires insulin signaling-mediated neuron-intestine communication. Hung WL, Wang Y, Chitturi J, Zhen M. Development. 2014 Apr;141(8):1767-79. doi: 10.1242/dev.103846. Epub 2014 Mar 26. 10.1242/dev.103846 PubMed 24671950