pJH2933
(Plasmid #132363)

• Purpose: Prgef-1 INS-3::GFP unc-54 3' UTR C.elegans pan-neural expression of INS-3::GFP
• Depositing Lab: Mei Zhen
• Publication: Hung et al Development. 2014 Apr;141(8):1767-79. doi: 10.1242/dev.103846. Epub 2014 Mar 26.

Backbone

• Vector backbone: pBSK
• Backbone manufacturer: stratagene
• Backbone size w/o insert (bp): 8291
• Total vector size (bp): 8703
• Vector type: Worm Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: INS-3
• Species: C. elegans (nematode)
• Insert Size (bp): 412
• Entrez Gene: ins-3 (a.k.a. CELE_ZK75.3)
• Promoter: Prgef-1
• Tag / Fusion Protein:
  • GFP (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BamHI (not destroyed)
• 3′ cloning site: BamHI (not destroyed)
• 5′ sequencing primer: gaccattaccaacgttctttc
• 3′ sequencing primer: AGGATGGGCACCACCCCGGTGAA

Resource Information

• Supplemental Documents:
  • pJH2916

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Industry MTA