pZmUBQ:Mla1
(Plasmid
#132355)
-
PurposeExpression of the barley Mla1 NLR from the Zea mays ubiquitin promotor
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132355 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepZmUBQ:GW-YFP
- Backbone size w/o insert (bp) 7344
- Total vector size (bp) 10221
-
Vector typePlant Expression
-
Selectable markersBasta
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameHvMla1
-
SpeciesHordeum vulgare
-
Insert Size (bp)2877
- Promoter pZmUBQ
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CACCCTGTTGTTTGGTGTTACTTC (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Mla1 CDS is expressed without the YFP fusion encoded in the vector
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZmUBQ:Mla1 was a gift from Paul Schulze-Lefert (Addgene plasmid # 132355 ; http://n2t.net/addgene:132355 ; RRID:Addgene_132355) -
For your References section:
A cell death assay in barley and wheat protoplasts for identification and validation of matching pathogen AVR effector and plant NLR immune receptors. Saur IML, Bauer S, Lu X, Schulze-Lefert P. Plant Methods. 2019 Oct 24;15:118. doi: 10.1186/s13007-019-0502-0. eCollection 2019. 10.1186/s13007-019-0502-0 PubMed 31666804