FUGW-H2B-mCherry
(Plasmid #132333)

• Purpose: Third generation lentiviral vector for hUbC-driven H2B-mCherry expression
• Depositing Lab: Bjoern Schwer
• Publication: Lentiviral expression vector for H2B-mCherry (unpublished)

Backbone

• Vector backbone: FUGW (Addgene #14883)
• Backbone size w/o insert (bp): 9197
• Total vector size (bp): 10286
• Modifications to backbone: eGFP was released from FUGW via XbaI digest and replaced with H2B-mCherry.
• Vector type: Mammalian Expression, Lentiviral

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: H2B-mCherry
• Insert Size (bp): 1089
• Promoter: hUbC

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XbaI (not destroyed)
• 3′ cloning site: XbaI (not destroyed)
• 5′ sequencing primer: hUBCpro-F (CCCCGTAATGCAGAAGAAGA)

Resource Information

• Supplemental Documents:
  • FUGW-H2B-mCherry.gb
• A portion of this plasmid was derived from a plasmid made by: H2B-mCherry was a gift from David Morgan, UCSF.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry