Skip to main content
Addgene

pAAV-EF1a-DIO-ASAP3Kv-WPRE
(Plasmid #132330)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 132330 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pAAV-EF1a
  • Backbone manufacturer
    addgene
  • Backbone size w/o insert (bp) 5596
  • Total vector size (bp) 7111
  • Vector type
    Mammalian Expression, AAV, Cre/Lox

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    ASAP3KV
  • Alt name
    Soma-located Accelerated Sensor of Action Potentials 3
  • Species
    Synthetic
  • Insert Size (bp)
    1515
  • Promoter EF1a

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AscI (not destroyed)
  • 3′ cloning site NheI (not destroyed)
  • 5′ sequencing primer tcaagcctcagacagtggttc
  • 3′ sequencing primer catagcgtaaaaggagcaaca
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-EF1a-DIO-ASAP3Kv-WPRE was a gift from Michael Lin (Addgene plasmid # 132330 ; http://n2t.net/addgene:132330 ; RRID:Addgene_132330)
  • For your References section:

    Ultrafast Two-Photon Imaging of a High-Gain Voltage Indicator in Awake Behaving Mice. Villette V, Chavarha M, Dimov IK, Bradley J, Pradhan L, Mathieu B, Evans SW, Chamberland S, Shi D, Yang R, Kim BB, Ayon A, Jalil A, St-Pierre F, Schnitzer MJ, Bi G, Toth K, Ding J, Dieudonne S, Lin MZ. Cell. 2019 Dec 12;179(7):1590-1608.e23. doi: 10.1016/j.cell.2019.11.004. 10.1016/j.cell.2019.11.004 PubMed 31835034