-
Purposeexpresses ASAP3(ASAP-family genetically encoded voltage indicator) in cre recombinase expressing mouse/cell, gene delivered by pAAV-EF1a vector
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 132318 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepAAV-EF1a
-
Backbone manufactureraddgene
- Backbone size w/o insert (bp) 5599
- Total vector size (bp) 6877
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameASAP3
-
Alt nameAccelerated Sensor of Action Potentials 3
-
SpeciesSynthetic
-
Insert Size (bp)1278
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AscI (not destroyed)
- 3′ cloning site NheI (not destroyed)
- 5′ sequencing primer tcaagcctcagacagtggttc
- 3′ sequencing primer catagcgtaaaaggagcaaca (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-EF1a-DIO-ASAP3-WPRE was a gift from Michael Lin (Addgene plasmid # 132318 ; http://n2t.net/addgene:132318 ; RRID:Addgene_132318) -
For your References section:
Ultrafast Two-Photon Imaging of a High-Gain Voltage Indicator in Awake Behaving Mice. Villette V, Chavarha M, Dimov IK, Bradley J, Pradhan L, Mathieu B, Evans SW, Chamberland S, Shi D, Yang R, Kim BB, Ayon A, Jalil A, St-Pierre F, Schnitzer MJ, Bi G, Toth K, Ding J, Dieudonne S, Lin MZ. Cell. 2019 Dec 12;179(7):1590-1608.e23. doi: 10.1016/j.cell.2019.11.004. 10.1016/j.cell.2019.11.004 PubMed 31835034