pMH610
(Plasmid #131862)

• Purpose: Produces holo-PhyB* in E. coli
• Depositing Lab: Wilfried Weber
• Publication: Horner et al ACS Synth Biol. 2019 Sep 26. doi: 10.1021/acssynbio.9b00267.

Backbone

• Vector backbone: pCDFDuet-1
• Backbone manufacturer: Novagen
• Vector type: Bacterial Expression

Growth in Bacteria

• Bacterial Resistance(s): Streptomycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: Low Copy

Gene/Insert 1

• Gene/Insert name: PhyB(1-651)-RGD-His6-Cys
• Alt name: PhyB*
• Species: A. thaliana (mustard weed), Synthetic
• Insert Size (bp): 2034
• Promoter: T7 promoter-1

Cloning Information for Gene/Insert 1

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GGATCTCGACGCTCTCCCT

Gene/Insert 2

• Gene/Insert name: HO1
• Species: Synechocystis PCC 6803
• Insert Size (bp): 723
• Promoter: T7 promoter-2

Cloning Information for Gene/Insert 2

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTGTACACGGCCGCATAATC

Gene/Insert 3

• Gene/Insert name: PcyA
• Species: Synechocystis PCC 6803
• Insert Size (bp): 747
• Promoter: T7 promoter-2

Cloning Information for Gene/Insert 3

• Cloning method: Gibson Cloning
• 5′ sequencing primer: TTGTACACGGCCGCATAATC
• 3′ sequencing primer: GGGTTATGCTAGTTATTGC

Resource Information

• Supplemental Documents:
  • pMH610.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry