pZmUBQ:LUC
(Plasmid
#131860)
-
PurposeTransient expression of firefly luciferase from the Zea mays ubiquitin promotor
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131860 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepZmUBQ
- Backbone size w/o insert (bp) 4344
- Total vector size (bp) 5997
-
Vector typePlant Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameluciferase
-
Speciesfirefly
-
Insert Size (bp)1653
- Promoter ZmUBQ
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer TTAGCCCTGCCTTCATACGC
- 3′ sequencing primer ACCGCGCGCGATAATTTATC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZmUBQ:LUC was a gift from Paul Schulze-Lefert (Addgene plasmid # 131860 ; http://n2t.net/addgene:131860 ; RRID:Addgene_131860) -
For your References section:
A cell death assay in barley and wheat protoplasts for identification and validation of matching pathogen AVR effector and plant NLR immune receptors. Saur IML, Bauer S, Lu X, Schulze-Lefert P. Plant Methods. 2019 Oct 24;15:118. doi: 10.1186/s13007-019-0502-0. eCollection 2019. 10.1186/s13007-019-0502-0 PubMed 31666804
Map uploaded by the depositor.
