Skip to main content
Addgene

NLS-SuperNova
(Plasmid #131858)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131858 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pEGFP-C1
  • Backbone manufacturer
    CloneTech
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    SuperNova
  • Species
    Synthetic
  • Promoter cmv
  • Tags / Fusion Proteins
    • Myc tag (C terminal on insert)
    • c-myc nuclear localization signal (NLS) (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NheI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
  • 3′ sequencing primer GAAATTTGTGATGCTATTGC
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Nuclear targeting was achieved by replacing EGFP in pEGFP-C1 with synthetic DNA coding for SuperNova with an N-terminal c-myc nuclear localization signal (NLS) using restriction sites NheI and HindIII. SuperNova sequence is from: Takemoto, K.; Matsuda, T.; Sakai, N.; Fu, D.; Noda, M.; Uchiyama, S.; Kotera, I.; Arai, Y.; Horiuchi, M.; Fukui, K.; et al. SuperNova, a monomeric photosensitizing fluorescent protein for chromophore-assisted light inactivation. Sci. Rep. 2013, 3, 2629.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NLS-SuperNova was a gift from Geert van den Bogaart (Addgene plasmid # 131858 ; http://n2t.net/addgene:131858 ; RRID:Addgene_131858)
  • For your References section:

    Radical Stress Is More Cytotoxic in the Nucleus than in Other Organelles. Paardekooper LM, van Vroonhoven E, Ter Beest M, van den Bogaart G. Int J Mol Sci. 2019 Aug 25;20(17). pii: ijms20174147. doi: 10.3390/ijms20174147. 10.3390/ijms20174147 PubMed 31450682