COX8-SuperNova
(Plasmid #131856)

• Purpose: Expresses SuperNova fused to mitochrondrial protein COX8A
• Depositing Lab: Geert van den Bogaart
• Publication: Paardekooper et al Int J Mol Sci. 2019 Aug 25;20(17). pii: ijms20174147. doi: 10.3390/ijms20174147.

Backbone

• Vector backbone: pEGFP-N1
• Backbone manufacturer: CloneTech
• Modifications to backbone: none
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Kanamycin, 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: SuperNova
• Species: Synthetic
• Promoter: CMV
• Tags / Fusion Proteins:
  • Myc tag (C terminal on insert)
  • Cox8A (N terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: XhoI (not destroyed)
• 3′ cloning site: NotI (not destroyed)
• 5′ sequencing primer: CGCAAATGGGCGGTAGGCGTG
• 3′ sequencing primer: GAAATTTGTGATGCTATTGC

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

The construct for cytosolic expression of SuperNova was constructed by replacing EGFP in pEGFP-N1 with synthetic SuperNova fused to a C-terminal Myc-tag using restriction sites BamHI and NotI. Mitochondrial targeting was achieved by inserting COX8A into the cytosolic SuperNova vector using restriction sites XhoI and HindIII thereby tagging the C-terminus of COX8A with SuperNova.