pTol2-PcyA-IRES-HO1
(Plasmid #131787)

• Purpose: Tol2 bicistronic vector expressing PcyA and HO1 for Phycocyanobilin (PCB) synthesis, driven by heatshock promoter hsp70.
• Depositing Lab: George Eisenhoffer
• Publication: Yen et al Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31.

Backbone

• Vector backbone: pzTol2
• Backbone manufacturer: VectorBuilder
• Backbone size w/o insert (bp): 2800
• Total vector size (bp): 6554
• Vector type: Mammalian Expression, Synthetic Biology ; Zebrafish Tol2 transposon

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PcyA and HO1
• Species: H. sapiens (human), Synthetic; Thermosynechococcus elongatus
• Insert Size (bp): 2238
• Promoter: hsp70
• Tag / Fusion Protein:
  • MTS (Mitochondrial Targeting Signal from subunit VIII of human cytochrome C oxidase) (N terminal on insert)

Cloning Information

• Cloning method: Gateway Cloning
• 5′ sequencing primer: attB1: GTTTGTACAAAAAAGCAGGC
• 3′ sequencing primer: IRES-F

Resource Information

• Supplemental Documents:
  • pzTol2-PcyA-IRES-HO1.gbk
• A portion of this plasmid was derived from a plasmid made by: The insert sequences are provided by Dr. Wilfried Weber from the University of Freiberg.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Read the preprint at bioRxiv: doi.org/10.1101/823971.

This vector is designed by Dr. Shuo-Ting Yen from Eisenhoffer lab and synthesized by VectorBuilder.