Skip to main content
Addgene

pAAV-CreLite
(Plasmid #131785)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131785 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    From William Lagor Lab
  • Backbone size w/o insert (bp) 3271
  • Total vector size (bp) 6862
  • Modifications to backbone
    Removed WPRE sequence and added a synthetic polyA sequence
  • Vector type
    Mammalian Expression, AAV, Cre/Lox, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    PhyBCreC-P2A-PIF6CreN
  • Alt name
    CreALite
  • Species
    A. thaliana (mustard weed), Synthetic; Bacteriophage P1
  • Insert Size (bp)
    3591
  • GenBank ID
    816394 825382
  • Promoter CBh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site MluI (not destroyed)
  • 5′ sequencing primer CBh_F: ttctgcttcactctccccatc
  • 3′ sequencing primer SynPA Rev: cacacaaaaaaccaacacacagatctaatg
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This synthetic gene was originally designed and cloned by Shuo-Ting Yen and then the sequence was modified by William Lagor for cloning purpose. Finally, the insert was synthesized by GeneWiz. The final cloning step is done by Shuo-Ting Yen.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Read the preprint at bioRxiv: doi.org/10.1101/823971.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-CreLite was a gift from George Eisenhoffer (Addgene plasmid # 131785 ; http://n2t.net/addgene:131785 ; RRID:Addgene_131785)
  • For your References section:

    CreLite: An optogenetically controlled Cre/loxP system using red light. Yen ST, Trimmer KA, Aboul-Fettouh N, Mullen RD, Culver JC, Dickinson ME, Behringer RR, Eisenhoffer GT. Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31. 10.1002/dvdy.232 PubMed 32745301