pAAV-CreLite
(Plasmid #131785)

• Purpose: AAV donor/transfer vector expressing CreLite system components, PhyBΔCreC and PIF6CreN, driven by CBh promoter
• Depositing Lab: George Eisenhoffer
• Publication: Yen et al Dev Dyn. 2020 Nov;249(11):1394-1403. doi: 10.1002/dvdy.232. Epub 2020 Aug 31.

Want a viral vector made from this plasmid?

Make a packaging request and we'll get back to you.

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.

• Serotype: Select serotype for details See details about
• Pricing: Select serotype and quantity $ USD for preparation of µL virus + $30 USD for plasmid.
• How this works:
  • Place a request for a quantity of 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
  • Addgene will quickly confirm that we can produce a high-quality prep for you.
  • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
  • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
  • Learn more about our Packaged on Request Service.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: From William Lagor Lab
• Backbone size w/o insert (bp): 3271
• Total vector size (bp): 6862
• Modifications to backbone: Removed WPRE sequence and added a synthetic polyA sequence
• Vector type: Mammalian Expression, AAV, Cre/Lox, Synthetic Biology

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: PhyBCreC-P2A-PIF6CreN
• Alt name: CreALite
• Species: A. thaliana (mustard weed), Synthetic; Bacteriophage P1
• Insert Size (bp): 3591
• GenBank ID: 816394 825382
• Promoter: CBh

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: MluI (not destroyed)
• 5′ sequencing primer: CBh_F: ttctgcttcactctccccatc
• 3′ sequencing primer: SynPA Rev: cacacaaaaaaccaacacacagatctaatg

Resource Information

• Supplemental Documents:
  • pAAV-CreLite.gbk
• A portion of this plasmid was derived from a plasmid made by: This synthetic gene was originally designed and cloned by Shuo-Ting Yen and then the sequence was modified by William Lagor for cloning purpose. Finally, the insert was synthesized by GeneWiz. The final cloning step is done by Shuo-Ting Yen.

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

Read the preprint at bioRxiv: doi.org/10.1101/823971.