pFA0057
(Plasmid #131784)

• Purpose: Guide RNA (gGFP) and Cas9 expression plasmid for cleaving pFA6 series GFP C-terminal tagging cassettes, including GFP-His3MX6. Used to perform CRISPR-Swap of alleles.
• Depositing Lab: Frank Albert
• Publication: Lutz et al PLoS Genet. 2019 Nov 18;15(11):e1008375. doi: 10.1371/journal.pgen.1008375. eCollection 2019 Nov.

Backbone

• Vector backbone: pML107 (addgene #67639)
• Backbone size w/o insert (bp): 12364
• Total vector size (bp): 12384
• Vector type: Bacterial Expression, Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 20mer GFP cassette guide (gGFP) and 5' sgRNA
• Alt name: gRNA sequence - CCCGGGTTAATTAACAGTAA
• Species: S. cerevisiae (budding yeast)
• Insert Size (bp): 20

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BclI (destroyed during cloning)
• 3′ cloning site: SwaI (destroyed during cloning)
• 5′ sequencing primer: M13 Reverse or T3

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry