pFA0057
(Plasmid
#131784)
-
PurposeGuide RNA (gGFP) and Cas9 expression plasmid for cleaving pFA6 series GFP C-terminal tagging cassettes, including GFP-His3MX6. Used to perform CRISPR-Swap of alleles.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 131784 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepML107 (addgene #67639)
- Backbone size w/o insert (bp) 12364
- Total vector size (bp) 12384
-
Vector typeBacterial Expression, Yeast Expression
-
Selectable markersLEU2
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert name20mer GFP cassette guide (gGFP) and 5' sgRNA
-
Alt namegRNA sequence - CCCGGGTTAATTAACAGTAA
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)20
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BclI (destroyed during cloning)
- 3′ cloning site SwaI (destroyed during cloning)
- 5′ sequencing primer M13 Reverse or T3 (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFA0057 was a gift from Frank Albert (Addgene plasmid # 131784 ; http://n2t.net/addgene:131784 ; RRID:Addgene_131784) -
For your References section:
DNA variants affecting the expression of numerous genes in trans have diverse mechanisms of action and evolutionary histories. Lutz S, Brion C, Kliebhan M, Albert FW. PLoS Genet. 2019 Nov 18;15(11):e1008375. doi: 10.1371/journal.pgen.1008375. eCollection 2019 Nov. 10.1371/journal.pgen.1008375 PubMed 31738765