pAAV-nEF-Con/Fon TVA-mCherry
(Plasmid #131779)

• Purpose: INTRSECT 2.0
• Depositing Lab: Karl Deisseroth
• Publication: Hafner et al Cell Rep. 2019 Sep 24;28(13):3450-3461.e8. doi: 10.1016/j.celrep.2019.08.064.

Backbone

• Vector backbone: pAAV
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 4861
• Total vector size (bp): 6461
• Modifications to backbone: none
• Vector type: Mammalian Expression, AAV ; INTRSECT

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Growth instructions: Stbl3 Cells can also be used for the transformation
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: TVA-mCherry
• Species: G. gallus (chicken)
• Insert Size (bp): 1600
• Promoter: nEF
• Tag / Fusion Protein:
  • mCherry (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: AscI (not destroyed)
• 3′ cloning site: SacI (not destroyed)
• 5′ sequencing primer: GTTTAAAGCTCAGGTCGAGA
• 3′ sequencing primer: GAATACCAGTCAATCTTTCAC

Resource Information

• Supplemental Documents:
  • pAAV-nEF-ConFon TVA-mCherry.gb
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Takara Bio Limited Use Label License (formerly Clontech)
• Industry Terms:
  • Not Available to Industry