Skip to main content
Addgene

pAAV-Ef1a-Con/Fon oG
(Plasmid #131778)

Print

Ordering

This material is available to academics and nonprofits only. Orders shipped outside the U.S. may require additional regulatory approval, as well as a non-refundable export license fee of $85. Please log in to view availability.
Item Catalog # Description Quantity Price (USD)
Plasmid 131778 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5571
  • Total vector size (bp) 7488
  • Modifications to backbone
    none
  • Vector type
    Mammalian Expression, AAV ; INTRSECT

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Growth instructions
    Can also use Stbl3 cells
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    rabies glycoprotein - oG
  • Species
    Synthetic
  • Insert Size (bp)
    1917
  • Promoter Ef1a
  • Tag / Fusion Protein
    • none

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer GTTAGGCCAGCTTGGCACTTG
  • 3′ sequencing primer GAATACCAGTCAATCTTTCAC
    • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-Con/Fon oG was a gift from Karl Deisseroth (Addgene plasmid # 131778 ; http://n2t.net/addgene:131778 ; RRID:Addgene_131778)

  • For your References section:

    Mapping Brain-Wide Afferent Inputs of Parvalbumin-Expressing GABAergic Neurons in Barrel Cortex Reveals Local and Long-Range Circuit Motifs. Hafner G, Witte M, Guy J, Subhashini N, Fenno LE, Ramakrishnan C, Kim YS, Deisseroth K, Callaway EM, Oberhuber M, Conzelmann KK, Staiger JF. Cell Rep. 2019 Sep 24;28(13):3450-3461.e8. doi: 10.1016/j.celrep.2019.08.064. 10.1016/j.celrep.2019.08.064 PubMed 31553913
Related items:
Commonly requested with: