pFA0055
(Plasmid #131774)

• Purpose: Guide RNA (gCASS5a) and Cas9 expression plasmid for cleaving pFA6 series deletion cassettes, including KanMX, hphMX and natMX. Used to perform CRISPR-Swap of alleles.
• Depositing Lab: Frank Albert
• Publication: Lutz et al PLoS Genet. 2019 Nov 18;15(11):e1008375. doi: 10.1371/journal.pgen.1008375. eCollection 2019 Nov.

Backbone

• Vector backbone: pML107 (addgene #67639)
• Backbone size w/o insert (bp): 12364
• Total vector size (bp): 12384
• Vector type: Bacterial Expression, Yeast Expression
• Selectable markers: LEU2

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: 20mer CASS5a guide (gCASS5a) and 5' sgRNA
• gRNA/shRNA sequence: ACGGATCCCCGGGTTAATTA
• Species: S. cerevisiae (budding yeast)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BclI (not destroyed)
• 3′ cloning site: SwaI (destroyed during cloning)
• 5′ sequencing primer: M13 rev or T3

Resource Information

• Articles Citing this Plasmid:
  • 3 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry