pAWp63-clone32 (Opti-SpCas9)
(Plasmid #131736)

• Purpose: Expresses Opti-SpCas9 in mammalian cells
• Depositing Lab: Alan Siu Lun Wong
• Publication: Choi et al Nat Methods. 2019 Aug;16(8):722-730. doi: 10.1038/s41592-019-0473-0. Epub 2019 Jul 15.

Backbone

• Vector backbone: pFUGW
• Total vector size (bp): 13045
• Vector type: Lentiviral
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): NEB Stable
• Copy number: Unknown

Gene/Insert

• Gene/Insert name: Opti-SpCas9
• Species: Synthetic
• Insert Size (bp): 4716
• Mutation: R661A+K1003H
• Promoter: EFS
• Tag / Fusion Protein:
  • Flag

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: - (unknown if destroyed)
• 3′ cloning site: - (unknown if destroyed)
• 5′ sequencing primer: GGCTCCGATCAGGTTCTTCTTGATGC
• 3′ sequencing primer: CATAGCGTAAAAGGAGCAACA

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The gene sequence was originally cloned by Dr. Feng Zhang’s group at MIT, which have been deposited the plasmid to Addgene (#49535 and #71814), and were used as the backbone to generate mutations and derive the plasmids deposited by us.
• Article Citing this Plasmid:
  • 1 Reference

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry