Skip to main content
Addgene

MADR pDonor TagBFP2-V5-HRAS G12V WPRE RCE
(Plasmid #131730)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131730 Standard format: Plasmid sent in bacteria as agar stab 1 $85
Add to Cart

Backbone

  • Vector backbone
    MADR pdonor
  • Backbone manufacturer
    Breunig Lab
  • Total vector size (bp) 6483
  • Modifications to backbone
    LoxP site orientation modified to be compatible with Rosa26 Cag EGFP (i.e. RCE:LoxP) mouse line from the laboratory of Gord Fishell (https://www.jax.org/strain/010701).
  • Vector type
    Mammalian Expression, Cre/Lox, Synthetic Biology ; Mosaic analysis for dual recombinase-mediated cassette exchange (MADR) donor

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TagBFP2-V5-HRAS G12V
  • Species
    H. sapiens (human); Entacmaea quadricolor (TagBFP)
  • Mutation
    G12V
  • Entrez Gene
    HRAS (a.k.a. C-BAS/HAS, C-H-RAS, C-HA-RAS1, CTLO, H-RASIDX, HAMSV, HRAS1, RASH1, p21ras)
  • Promoter none (4x polyA to mitigate episomal expression)
  • Tag / Fusion Protein
    • TagBFP2-V5 tag (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer MADR-MCSF (TCGACCTGCAGCCCAAGCTA)
  • 3′ sequencing primer WPRE-R (addgene)
    • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Mutated TagBFP to TagBFP2 (I174A substitution)
Compatible with RCE:loxP mouse strain (https://www.jax.org/strain/010701) but not with mt/mg strain. Can be used as a negative control for MADR insertion in mt/mg line.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    MADR pDonor TagBFP2-V5-HRAS G12V WPRE RCE was a gift from Joshua Breunig (Addgene plasmid # 131730 ; http://n2t.net/addgene:131730 ; RRID:Addgene_131730)

  • For your References section:

    Rapid Generation of Somatic Mouse Mosaics with Locus-Specific, Stably Integrated Transgenic Elements. Kim GB, Rincon Fernandez Pacheco D, Saxon D, Yang A, Sabet S, Dutra-Clarke M, Levy R, Watkins A, Park H, Abbasi Akhtar A, Linesch PW, Kobritz N, Chandra SS, Grausam K, Ayala-Sarmiento A, Molina J, Sedivakova K, Hoang K, Tsyporin J, Gareau DS, Filbin MG, Bannykh S, Santiskulvong C, Wang Y, Tang J, Suva ML, Chen B, Danielpour M, Breunig JJ. Cell. 2019 Sep 19;179(1):251-267.e24. doi: 10.1016/j.cell.2019.08.013. 10.1016/j.cell.2019.08.013 PubMed 31539496
Related items:
Commonly requested with: