Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pFDH
(Plasmid #131706)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131706 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pZE21-MCS
  • Backbone manufacturer
    Expressys
  • Backbone size w/o insert (bp) 1799
  • Total vector size (bp) 3023
  • Modifications to backbone
    SmR gene instead of KanR
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Streptomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    formate dehydrogenase
  • Alt name
    fdh
  • Species
    Pseudomonas sp. 101
  • Insert Size (bp)
    1224
  • GenBank ID
    P33160
  • Tag / Fusion Protein
    • his-tag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TCTCGAGACCTATTGACAAT
  • 3′ sequencing primer TCACCGACAAACAACAGATA
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Dr. Yehudit Zohar, Weizmann Institute of Science, Rehovot, Israel

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFDH was a gift from Ron Milo (Addgene plasmid # 131706 ; http://n2t.net/addgene:131706 ; RRID:Addgene_131706)
  • For your References section:

    Conversion of Escherichia coli to Generate All Biomass Carbon from CO2. Gleizer S, Ben-Nissan R, Bar-On YM, Antonovsky N, Noor E, Zohar Y, Jona G, Krieger E, Shamshoum M, Bar-Even A, Milo R. Cell. 2019 Nov 27;179(6):1255-1263.e12. doi: 10.1016/j.cell.2019.11.009. 10.1016/j.cell.2019.11.009 PubMed 31778652