Thy1.1-GFP
(Plasmid
#131703)
-
Purposeencodes Thy1.1 followed by a P2A site and GFP for enriching pure populations of transfected cells
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131703 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 5209
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameThy1.1-GFP
-
Alt nameCD90.1
-
Insert Size (bp)1272
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer aaaatttaacgcgaattttaacaaa (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Thy1.1-GFP was a gift from Britt Glaunsinger (Addgene plasmid # 131703 ; http://n2t.net/addgene:131703 ; RRID:Addgene_131703) -
For your References section:
Changes in mRNA abundance drive shuttling of RNA binding proteins, linking cytoplasmic RNA degradation to transcription. Gilbertson S, Federspiel JD, Hartenian E, Cristea IM, Glaunsinger B. Elife. 2018 Oct 3;7. pii: 37663. doi: 10.7554/eLife.37663. 10.7554/eLife.37663 PubMed 30281021
Map uploaded by the depositor.
