GFP-muSOX
(Plasmid
#131701)
-
Purposeexpresses muSOX with GFP N-terminally fused
-
Depositing Lab
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 131701 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepCMV
- Total vector size (bp) 6216
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-muSOX
-
Alt namemORF37
-
SpeciesMHV68
-
Insert Size (bp)2205
-
GenBank ID
-
Entrez GeneGAMMAHV.ORF37
- Promoter CMV
-
Tag
/ Fusion Protein
- GFP (N terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer aaaatttaacgcgaattttaacaaa (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byGlaunsinger Lab
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
GFP-muSOX was a gift from Britt Glaunsinger (Addgene plasmid # 131701 ; http://n2t.net/addgene:131701 ; RRID:Addgene_131701) -
For your References section:
Changes in mRNA abundance drive shuttling of RNA binding proteins, linking cytoplasmic RNA degradation to transcription. Gilbertson S, Federspiel JD, Hartenian E, Cristea IM, Glaunsinger B. Elife. 2018 Oct 3;7. pii: 37663. doi: 10.7554/eLife.37663. 10.7554/eLife.37663 PubMed 30281021
Map uploaded by the depositor.
