Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH
(Plasmid #131683)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 131683 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pOTTC1553
  • Backbone manufacturer
    NIDA GEVVC
  • Vector type
    AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Low Copy

Gene/Insert 1

  • Gene/Insert name
    EGFP-KASH
  • Alt name
    Green Fluorescent Protein fused to KASH nuclear envelope localization domain
  • Species
    Synthetic
  • Promoter EF1a
  • Tag / Fusion Protein
    • KASH (C terminal on insert)

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    SpCas9 sgRNA vs mouse GRID1
  • Alt name
    GAACCCTAGCCCTGACGGCG
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    20
  • Promoter mU6

Cloning Information for Gene/Insert 2

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pOTTC1706 - pAAV mGrid1 390F gRNA EF1a EGFP-KASH was a gift from Christopher Richie (Addgene plasmid # 131683 ; http://n2t.net/addgene:131683 ; RRID:Addgene_131683)
  • For your References section:

    Delta glutamate receptor conductance drives excitation of mouse dorsal raphe neurons. Gantz SC, Moussawi K, Hake HS. Elife. 2020 Apr 1;9. pii: 56054. doi: 10.7554/eLife.56054. 10.7554/eLife.56054 PubMed 32234214