pGL4.23-SCP1-ccdB
(Plasmid #131628)

• Purpose: (Empty Backbone) Modified STARR-seq plasmid to measure enhancer activity (SCP1 promoter; ccdb gene at cloning site)
• Depositing Lab: Kevin White
• Publication: Liu et al Genome Biol. 2017 Nov 20;18(1):219. doi: 10.1186/s13059-017-1345-5.

Backbone

• Vector backbone: pGL4.23
• Backbone manufacturer: Promega
• Backbone size (bp): 5813
• Modifications to backbone: Minimal promoter was replaced with a synthesized Super core promoter 1 (SCP1). The CmR-ccdB suicide gene was PCR amplified from the STARR-seq vector (kindly provided by Dr. Alexander Stark) using primers containing the SphI-HF and the NdeI recognition site. It was then assembled with the linearized pGL4.23-SCP1 vector (digested by FseI) using Gibson assembly
• Vector type: Mammalian Expression, Bacterial Expression, Luciferase
• Promoter: SCP1

Growth in Bacteria

• Bacterial Resistance(s): Chloramphenicol and Ampicillin, 25 & 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): ccdB Survival
• Copy number: High Copy

Cloning Information

• Cloning method: Gibson Cloning
• 5′ sequencing primer: GTGCTGGAACACGGTAAA
• 3′ sequencing primer: CGACGGATCCTTATCGATTT

Resource Information

• Supplemental Documents:
  • pgl4-23_scp1_ccdb.gb

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
  • Luciferase Limited Use Label License
• Industry Terms:
  • Not Available to Industry